lsm10

Ensembl ID:
ENSDARG00000094513
ZFIN ID:
ZDB-GENE-090508-7
Description:
Novel protein similar to vertebrate LSM10, U7 small nuclear RNA associated (LSM10) [Source:UniProtKB
Human Orthologue:
LSM10
Human Description:
LSM10, U7 small nuclear RNA associated [Source:HGNC Symbol;Acc:17562]
Mouse Orthologue:
Lsm10
Mouse Description:
U7 snRNP-specific Sm-like protein LSM10 Gene [Source:MGI Symbol;Acc:MGI:2151045]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9747 Nonsense Available for shipment Available now
sa18537 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9747
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000145084 Nonsense 34 120 2 2
ENSDART00000145084 Nonsense 34 120 2 2
Genomic Location:
Chromosome 19 (position 2924618)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTGATCCTCCTGCAGGGTCTGCATGGACAGGTGACCACCGTTGACCTG[C/T]GAGAYGAGAGCACAGCGAGGGGCAGAGTGWTAAATGTGGACGCTTTCATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18537
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000145084 Nonsense 34 120 2 2
ENSDART00000145084 Nonsense 34 120 2 2
Genomic Location:
Chromosome 19 (position 2924618)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTGATCCTCCTGCAGGGTCTGCATGGACAGGTGACCACCGTTGACCTG[C/T]GAGAYGAGAGCACAGCGAGGGGCAGAGTGATAAATGTGGACGCTTTCATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/yh2l8mov