ENSDARG00000094479

Ensembl ID:
ENSDARG00000094479

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24061 Nonsense Available for shipment Available now
sa19277 Nonsense Mutation detected in F1 DNA During 2014
sa9333 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24061
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142849 Nonsense 233 654 2 3
Genomic Location:
Chromosome 22 (position 3165534)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGAGACAGCACCAGAGGGTTCACACTGGAGAGAAACCGTACAAGTGTT[C/A]ACACTGCAACAAGAGATTCCGACTGTCTGGTACCCTTAAACATCACAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19277
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142849 Nonsense 409 654 2 3
ENSDART00000142849 Nonsense 409 654 2 3
Genomic Location:
Chromosome 22 (position 3166061)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTGGAGAGAAACCGTACACGTGTACTCAGTGTGGGCAAAGTTTCACA[C/T]GATTAGCAAACCTTAATAAACATGTGCTGAACCACACTAGAGAGACAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9333
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142849 Nonsense 409 654 2 3
ENSDART00000142849 Nonsense 409 654 2 3
Genomic Location:
Chromosome 22 (position 3166061)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACTGGAGAGAAACCGTACACGTGTACTCAGTGTGGGCAAAGTTTCACA[C/T]GATTAGCAAACCTTAATAAACATGTGCTGAACCACACTAGAGAGACAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/j3wnjhyj