txnrd2

Ensembl ID:
ENSDARG00000094470
ZFIN ID:
ZDB-GENE-081104-217
Description:
Novel protein similar to vertebrate thioredoxin reductase 2 (TXNRD2) [Source:UniProtKB/TrEMBL;Acc:B8
Human Orthologue:
TXNRD2
Human Description:
thioredoxin reductase 2 [Source:HGNC Symbol;Acc:18155]
Mouse Orthologue:
Txnrd2
Mouse Description:
thioredoxin reductase 2 Gene [Source:MGI Symbol;Acc:MGI:1347023]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa8420 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa8420
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000139203 Essential Splice Site 166 206 None 6

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 5 (position 17015823)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGGCCGAACGCTGGTGAAGTCACACAGGGCTTTGCTTTGGGCTTCCAG[T/C]ACGTTCCRCACRTCTCTGTAAACTTGCACATGATGMTGGGCTGGAATCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hgqhjzkn