si:ch73-199e17.1

Ensembl ID:
ENSDARG00000094466
ZFIN ID:
ZDB-GENE-100921-8
Description:
tubulin alpha 8-like 3b [Source:RefSeq peptide;Acc:NP_001161759]
Human Orthologue:
TUBA4A
Human Description:
tubulin, alpha 4a [Source:HGNC Symbol;Acc:12407]
Mouse Orthologue:
Tuba4a
Mouse Description:
tubulin, alpha 4A Gene [Source:MGI Symbol;Acc:MGI:1095410]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21433 Nonsense Available for shipment Available now
sa8481 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa21433
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016360 Nonsense 109 477 4 5
ENSDART00000102713 Nonsense 81 449 3 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 7720874)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 7700967
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACAGACTGACACTTTCAGCTTTTTGTAAATGTAGATGAAGTGCGGACA[G/T]GAACCTACCGCCAGCTCTTCCACCCTGAACAACTGATTACTGGGAAAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8481
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016360 Nonsense 248 477 5 5
ENSDART00000102713 Nonsense 220 449 4 4
Genomic Location (Zv9):
Chromosome 9 (position 7720345)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 7700438
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTGGACAATGAAGCCATCTACGACATCTGYCGCAAAAACCTGGACAWC[G/T]AGCGTCCGACCTACACCAACCTCAACAGGCTCATTGGGCAGATTGTGTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link