her4.2

Ensembl ID:
ENSDARG00000094426
ZFIN ID:
ZDB-GENE-060815-1
Description:
hairy-related 4.2-like [Source:RefSeq peptide;Acc:NP_001154881]
Human Orthologue:
HES5
Human Description:
hairy and enhancer of split 5 (Drosophila) [Source:HGNC Symbol;Acc:19764]
Mouse Orthologue:
Hes5
Mouse Description:
hairy and enhancer of split 5 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:104876]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1023 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1023
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104210 Essential Splice Site None 152 2 4
ENSDART00000137573 None None 152 2 2
Genomic Location:
Chromosome 23 (position 21750671)
KASP Assay ID:
554-0927.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTGTGTTGAAGCACAAATGATTGTTTTTAATATTTGCATGTGTTTACA[T/C]GAAGGAGACTTTTTCCCTGTATAGGGCAGCTCAATGTTTTCACTGTTAGT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/coqc76wh