kntc2l

Ensembl ID:
ENSDARG00000094424
ZFIN ID:
ZDB-GENE-030131-904
Human Orthologue:
NDC80
Human Description:
NDC80 homolog, kinetochore complex component (S. cerevisiae) [Source:HGNC Symbol;Acc:16909]
Mouse Orthologue:
Ndc80
Mouse Description:
NDC80 homolog, kinetochore complex component (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1914302

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22044 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22044
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142386 Nonsense 109 173 5 7

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 12 (position 11441918)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGCCTACTGCCAAAGTGGAGGAAGAGATCCCAAGAATGCTCAAAGATT[T/A]GGGGTAATCAATATTATTTTATCACTACACCCTGTACAATTTACAGTAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/m70jjdsh