si:dkey-218f9.10

Ensembl ID:
ENSDARG00000094353
ZFIN ID:
ZDB-GENE-070705-374
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A5WUZ7]
Human Orthologue:
TRAPPC9
Human Description:
trafficking protein particle complex 9 [Source:HGNC Symbol;Acc:30832]
Mouse Orthologue:
Trappc9
Mouse Description:
trafficking protein particle complex 9 Gene [Source:MGI Symbol;Acc:MGI:1923760]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3027 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa3027
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142409 Nonsense 88 449 2 8
Genomic Location (Zv9):
Chromosome 19 (position 4938404)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 4211965
KASP Assay ID:
554-3367.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGACCCACCGCAAAGTGGTCGGCCTCATTTCYGTRACCAGCTGCGGCT[C/G]AGCCAAAGAGTGGCCGCAAACTTCAGATCGTTTCCACGGGCAGAAAGAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link