si:dkey-20i20.11

Ensembl ID:
ENSDARG00000094343
ZFIN IDs:
ZDB-GENE-060503-58, ZDB-GENE-071004-118
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A3KPV0]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29694 Nonsense Mutation detected in F1 DNA During 2017
sa37403 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa29694
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133652   None 195 None 3
ENSDART00000144785 Nonsense 51 499 2 5
Genomic Location (Zv9):
Chromosome 22 (position 2003228)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2744318
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGGAGAAACATCAAGAAAAAACCCAATCAGAAACTGAACGTAGTATTT[C/A]AATGAAAGGAACAGCTGTAAATAGTTTGACCTGCACTCAGTGTGGAAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37403
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133652   None 195 None 3
ENSDART00000144785 Nonsense 126 499 2 5
Genomic Location (Zv9):
Chromosome 22 (position 2003452)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2744542
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCACACAGGAGAGAAGCCTTACCAGTGTTCATACTGCAGTAGGAGATTC[A/T]GACATTCAGGAGTCCTAAAAAAACACTTGAGGACTCACACTGGAGAGAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link