RASSF7 (1 of 3)

Ensembl ID:
ENSDARG00000094325
Description:
Ras association (RalGDS/AF-6) domain family (N-terminal) member 7 [Source:HGNC Symbol;Acc:1166]
Human Orthologue:
RASSF7
Human Description:
Ras association (RalGDS/AF-6) domain family (N-terminal) member 7 [Source:HGNC Symbol;Acc:1166]
Mouse Orthologue:
Rassf7
Mouse Description:
Ras association (RalGDS/AF-6) domain family (N-terminal) member 7 Gene [Source:MGI Symbol;Acc:MGI:19

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45022 Nonsense Mutation detected in F1 DNA During 2017
sa30265 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa45022
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000136169 Nonsense 268 415 2 4
Genomic Location (Zv9):
Chromosome 25 (position 26353379)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTGCATGAATTCAACAATCGTGCCATACAACTGGAGAAGGACATTCAG[A/T]GAGAAATGCTACGAGTTGACATTTTACCTGTTCAGTCCGATTCAAAAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30265
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000136169 Essential Splice Site 322 415 2 4
Genomic Location (Zv9):
Chromosome 25 (position 26353544)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 25393858
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTTAAAGAGCTTGAGAAGACTTTGGGGAGGGCTGAGACTTTGTTAAAG[G/A]TAAGTAGAGAGGGCCTGGCTCAAGAGAGAAGCTTGTAGGGGTTGACTGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link