si:ch211-29n12.1

Ensembl ID:
ENSDARG00000094311
ZFIN ID:
ZDB-GENE-060526-169
Description:
Novel protein containing sushi domains (SCR repeats) [Source:UniProtKB/TrEMBL;Acc:A2BIN9]
Human Orthologue:
SUSD1
Human Description:
sushi domain containing 1 [Source:HGNC Symbol;Acc:25413]
Mouse Orthologue:
Susd1
Mouse Description:
sushi domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:3651543]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38451 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38451
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000140066   None 269 None 6
ENSDART00000144325 Nonsense 216 329 4 7
ENSDART00000146643 Nonsense 125 381 3 9
Genomic Location (Zv9):
Chromosome 5 (position 9664283)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 8761877
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTCAATATGTGACATTACTGGAGAATGGCAGGTTGCCACTCTCCATTG[C/A]AGAGGTACACAGTCAATGATCCTCATTTACTAAATCTACTACTATTTACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link