ysk4

Ensembl ID:
ENSDARG00000094272
ZFIN ID:
ZDB-GENE-081104-140
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0S8J3]
Human Orthologue:
YSK4
Human Description:
YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:26249]
Mouse Orthologue:
Ysk4
Mouse Description:
Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1203481]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7182 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7182
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142008 Essential Splice Site 129 241 4 5
ENSDART00000147330 None None 297 None 3
Genomic Location:
Chromosome 9 (position 24264125)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACTACAGGGCTAAGARGTGTTGAAACTGGGGAAGATGAAAAGCAAAAG[G/T]TGAGGATTTRTTTATTTRYTTGTTTAACATTTCAATGAGACCAAACAGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/v098hhwg