si:ch211-15d5.2

Ensembl ID:
ENSDARG00000094258
ZFIN ID:
ZDB-GENE-070424-139
Description:
COMM domain-containing protein 9 [Source:RefSeq peptide;Acc:NP_001082867]
Human Orthologue:
COMMD9
Human Description:
COMM domain containing 9 [Source:HGNC Symbol;Acc:25014]
Mouse Orthologue:
Commd9
Mouse Description:
COMM domain containing 9 Gene [Source:MGI Symbol;Acc:MGI:1923751]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6477 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6477
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092925 Essential Splice Site 17 197 None 6

The following transcripts of ENSDARG00000094258 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 17 (position 24446891)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 24600333
KASP Assay ID:
554-5028.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCTTTCATGACACAAGATCAGTTCACTGCTTTGCAACTGCTGTTAAAGG[T/C]AGTGTAATATCACATACTGTTTAGTATATYGCTGAATTACTTGGCTTGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link