taar12h

Ensembl ID:
ENSDARG00000094237
ZFIN ID:
ZDB-GENE-041014-54
Description:
trace amine associated receptor 12h [Source:RefSeq peptide;Acc:NP_001076378]
Human Orthologue:
TAAR2
Human Description:
trace amine associated receptor 2 [Source:HGNC Symbol;Acc:4514]
Mouse Orthologues:
Taar2, Taar3
Mouse Descriptions:
trace amine-associated receptor 2 Gene [Source:MGI Symbol;Acc:MGI:2685071]
trace amine-associated receptor 3 Gene [Source:MGI Symbol;Acc:MGI:3527427]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16441 Nonsense Available for shipment Available now
sa16497 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16441
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000136254 Nonsense 317 344 1 1
ENSDART00000136254 Nonsense 317 344 1 1
Genomic Location:
Chromosome 20 (position 46272924)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCGGATACTTTAACTCCACCTGTAACCCACTGATCTATGGTTTCTTCTA[T/A]CCTCGCTTTCAGAAGGCCTTCAAGATTCTCATATCCACTTACATCTGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16497
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000136254 Nonsense 317 344 1 1
ENSDART00000136254 Nonsense 317 344 1 1
Genomic Location:
Chromosome 20 (position 46272924)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCGGATACTTTAACTCCACCTGTAACCCACTGATCTATGGTTTCTTCTA[T/A]CCTCGCTTTCAGAAGGCCTTCAAGATTCTCATATCCACTTACATCTGTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cy1wlqdc