si:ch211-125e6.14

Ensembl ID:
ENSDARG00000094183
ZFIN ID:
ZDB-GENE-070912-38
Description:
hypothetical protein LOC100002523 [Source:RefSeq peptide;Acc:NP_001104711]
Human Orthologues:
REG1A, REG1B, REG3A, REG3G, REG4
Human Descriptions:
regenerating islet-derived 1 alpha [Source:HGNC Symbol;Acc:9951]
regenerating islet-derived 1 beta [Source:HGNC Symbol;Acc:9952]
regenerating islet-derived 3 alpha [Source:HGNC Symbol;Acc:8601]
regenerating islet-derived 3 gamma [Source:HGNC Symbol;Acc:29595]
regenerating islet-derived family, member 4 [Source:HGNC Symbol;Acc:22977]
Mouse Orthologues:
Reg1, Reg2, Reg3a, Reg3b, Reg3d, Reg3g, Reg4
Mouse Descriptions:
regenerating islet-derived 1 Gene [Source:MGI Symbol;Acc:MGI:97895]
regenerating islet-derived 2 Gene [Source:MGI Symbol;Acc:MGI:97896]
regenerating islet-derived 3 alpha Gene [Source:MGI Symbol;Acc:MGI:109408]
regenerating islet-derived 3 beta Gene [Source:MGI Symbol;Acc:MGI:97478]
regenerating islet-derived 3 delta Gene [Source:MGI Symbol;Acc:MGI:1353426]
regenerating islet-derived 3 gamma Gene [Source:MGI Symbol;Acc:MGI:109406]
regenerating islet-derived family, member 4 Gene [Source:MGI Symbol;Acc:MGI:1914959]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13712 Essential Splice Site Available for shipment Available now
sa13654 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa13712
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135387 Essential Splice Site 74 132 3 4
ENSDART00000135387 Essential Splice Site 74 132 3 4
Genomic Location (Zv9):
Chromosome 9 (position 34256643)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33412589
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCTAATAAAGATGATTGATTCACTGTATAAATGCATTCTTCACTCATT[A/G]GGAAGGWCAGTGGCTGTGGACTGATGGATCTGTGWATRATTATACAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13654
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135387 Essential Splice Site 74 132 3 4
ENSDART00000135387 Essential Splice Site 74 132 3 4
Genomic Location (Zv9):
Chromosome 9 (position 34256643)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33412589
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTCTAATAAAGATGATTGATTCACTGTATAAATGCATTCTTCACTCATT[A/G]GGAAGGWCAGTGGCTGTGGACTGATGGATCTGTGWATRATTATACAAACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link