gnat2

Ensembl ID:
ENSDARG00000094180
ZFIN ID:
ZDB-GENE-011128-10
Description:
Guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2 [Source:Uni
Human Orthologues:
GNAT2, GNAT3
Human Descriptions:
guanine nucleotide binding protein (G protein), alpha transducing activity polypeptide 2 [Source:HGN
guanine nucleotide binding protein, alpha transducing 3 [Source:HGNC Symbol;Acc:22800]
Mouse Orthologues:
Gnat2, Gnat3
Mouse Descriptions:
guanine nucleotide binding protein, alpha transducing 2 Gene [Source:MGI Symbol;Acc:MGI:95779]
guanine nucleotide binding protein, alpha transducing 3 Gene [Source:MGI Symbol;Acc:MGI:3588268]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41206 Essential Splice Site Mutation detected in F1 DNA During 2017
sa25395 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa41206
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132697 Essential Splice Site 2 179 2 6

The following transcripts of ENSDARG00000094180 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 26085943)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25213861
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTATAGGTGCTGGTGAATCAGGGAAGAGCACCATTGTAAAACAGATGAA[G/A]TGAGTTGAAACACATGCGATATACAAAACACATGCTCAGATATGACAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25395
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000132697 Nonsense 56 179 4 6

The following transcripts of ENSDARG00000094180 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 26082296)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 25210214
KASP Assay ID:
554-7833.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAACAGTGCCCCCTTTTTCTGTCTCTTGTAGGAGGATAGTCAAAAGCTC[C/T]AGAACCTGTCTGACTCCATTGAGGAGGGCACCATGCCTCCAGAGCTGGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link