si:dkey-15h8.15

Ensembl ID:
ENSDARG00000094179
ZFIN ID:
ZDB-GENE-050208-626
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q1LW43]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24059 Nonsense Available for shipment Available now
sa13942 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24059
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000136926 Nonsense 173 256 2 2
ENSDART00000143091   None 196 None 3

The following transcripts of ENSDARG00000094179 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 3119339)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 1932187
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACGACGGTCATGTTTAAATGACCATCAGAAGACCCACACTGGTGTGCGA[G/T]AGTTCGTCTGCTCTGACTGTGGGAAGACTTTTATTAGAGCTGGAGCTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13942
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000136926 Nonsense 202 256 2 2
ENSDART00000143091   None 196 None 3

The following transcripts of ENSDARG00000094179 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 3119428)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 1932276
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCYGGAGCTTTGAAATTGCACCAGATGAKTCACACTGGAGAGAAACCGTA[C/A]AAGTGTTCACACTGCGACAAGACATTCAGACAATCMGGACACCTGAAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link