si:dkey-19f23.4

Ensembl ID:
ENSDARG00000094178
ZFIN ID:
ZDB-GENE-091204-435
Human Orthologue:
SBNO2
Human Description:
strawberry notch homolog 2 (Drosophila) [Source:HGNC Symbol;Acc:29158]
Mouse Orthologue:
Sbno2
Mouse Description:
strawberry notch homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2448490]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37491 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa37491
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000141844 Essential Splice Site 104 402 None 9

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 17935153)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 17686088
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGCATCATTCTAGAAAACAACTTAAAGGGAAGGAAAAAAGCACTATGG[T/A]GAGAAGCATCGACATCCAGCACAACTGACCGACTTTACTGGCACACTCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Crohn's disease: Genome-wide meta-analysis increases to 71 the number of confirmed Crohn's disease susceptibility loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link