ftr27

Ensembl ID:
ENSDARG00000094131
ZFIN ID:
ZDB-GENE-070912-318
Description:
Novel protein with Zinc finger, C3HC4 type (RING finger) and B-box zinc finger domains [Source:UniPr
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33023 Nonsense Mutation detected in F1 DNA During 2016
sa13910 Nonsense Available for shipment Available now
sa14647 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa33023
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135584 Nonsense 43 171 2 2
Genomic Location (Zv9):
Chromosome 2 (position 48059662)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 48091326
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACCATCCCCTGTGGCCACAGTTATTGTATGAACTGCATTACTGAATACT[G/A]GAATCGACGTGATCTGTCGATTAATAGCTGCCCTCAGTGCAGACAGACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13910
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135584 Nonsense 118 171 2 2
Genomic Location (Zv9):
Chromosome 2 (position 48059888)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 48091552
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGTTTGTAATGGGAGAAAACGCAAAGCTGTYAAATCCKGCYTAGTGTG[T/A]CTCGAATCTTACTGTCAGTGCCATTATGAGTCTCACGAAGAATCTCGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14647
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135584 Nonsense 147 171 2 2
Genomic Location (Zv9):
Chromosome 2 (position 48059973)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 48091637
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGAAGAATCTCGTTCAAAGAAGCGACATAAGRTAACTGATGCCACTAGA[C/T]GAATCCAGGATATAATCTGCTCCAAACAYGACCGACTGCTGGAGGTTTAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link