ENSDARG00000094127

Ensembl ID:
ENSDARG00000094127
Human Orthologue:
STK36
Human Description:
serine/threonine kinase 36 [Source:HGNC Symbol;Acc:17209]
Mouse Orthologue:
Stk36
Mouse Description:
serine/threonine kinase 36 (fused homolog, Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1920831]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4846 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa4846
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000145374 Nonsense 43 262 2 5
Genomic Location:
Chromosome 1 (position 25546481)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCCGCAGGTTGCCCTGAAGTTTATCAACAAGAATGAAGACGACCGTTA[T/A]CTTGACATTGTAAGTTGAATAATTTAAACAACAGTGAAAATGTGCTGACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pc31akgz