si:ch1073-412h12.1

Ensembl ID:
ENSDARG00000094115
ZFIN IDs:
ZDB-GENE-050208-113, ZDB-GENE-081031-83
Description:
Novel PX domain containing protein [Source:UniProtKB/TrEMBL;Acc:B8JLT3]
Human Orthologue:
RPS6KC1
Human Description:
ribosomal protein S6 kinase, 52kDa, polypeptide 1 [Source:HGNC Symbol;Acc:10439]
Mouse Orthologue:
Rps6kc1
Mouse Description:
ribosomal protein S6 kinase polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:2443419]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43370 Essential Splice Site Mutation detected in F1 DNA During 2017
sa12395 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa43370
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131461 Essential Splice Site 125 312 4 8

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 3309288)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3252942
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAATATTCCTGCTTTATATGGCAGTTCATACATTCAAGATTTCTTTAAG[G/A]TATGTTTGTATTTATTTATTTATTTATTTATTTATTTATTCCAAGGCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12395
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131461 Essential Splice Site 156 312 5 8

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 3304889)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 3248543
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCCTTTTCTGATTTTCTAGCTGAYAGYCTGTTAGACAGCAGTTCTGAAG[G/A]TARGTCTCTACACTATTTATTGCTCACAGGTTTATGTATTGCTCCCCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link