or128-6

Ensembl ID:
ENSDARG00000094092
ZFIN ID:
ZDB-GENE-070806-110
Description:
odorant receptor, family E, subfamily 128, member 6 [Source:RefSeq peptide;Acc:NP_001121861]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2804 Nonsense F2 line generated During 2017

Mutation Details

Allele Name:
sa2804
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000136845 Nonsense 301 305 1 1
Genomic Location (Zv9):
Chromosome 15 (position 5070602)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 5220655
KASP Assay ID:
554-2949.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTTTATGGGTTAAGTCTGTCAGATATTCGGAAGAAAAATATTTGCCTC[A/T]GAAAATTAACCAAGTAGATTACACAAACTAGTTTAGCTGTAAAAGAAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link