si:dkey-190a9.1

Ensembl ID:
ENSDARG00000094082
ZFIN ID:
ZDB-GENE-081029-2
Human Orthologue:
HIVEP3
Human Description:
human immunodeficiency virus type I enhancer binding protein 3 [Source:HGNC Symbol;Acc:13561]
Mouse Orthologue:
Hivep3
Mouse Description:
human immunodeficiency virus type I enhancer binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:10658

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23486 Nonsense Available for shipment Available now
sa43247 Nonsense Mutation detected in F1 DNA During 2017
sa36801 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa23486
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143480 Nonsense 9 1273 1 6

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 14765544)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 15429148
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTTGATGACCCGCAACCAATTCAGAATCGGCGCCATGGAATGCTAAGA[C/T]GACAGCCTGCAATTGAATTGCCAATTGGCGCTGAATTAACAATGGAGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43247
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143480 Nonsense 80 1273 1 6

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 14765331)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 15428935
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGATATCAAAAACACAAACAACACTGTTGCACAGTTCATATTTCTCAA[C/T]AATCTGAAATTCCTGTTTATCAAGTAGATGAATCCACAAGAACATTTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36801
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143480 Nonsense 699 1273 1 6

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 19 (position 14763474)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 15427078
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGGTGCTTTCTAAACTACATAAAGCCAAATCCATCCATACAGAGTGAA[C/T]AACAAAACTCAGTCTATTCTTCATGGTGTACAAGTACCCGCAATCCAAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link