taar20z

Ensembl ID:
ENSDARG00000094065
ZFIN ID:
ZDB-GENE-060414-14
Human Orthologues:
TAAR5, TAAR6, TAAR8
Human Descriptions:
trace amine associated receptor 5 [Source:HGNC Symbol;Acc:30236]
trace amine associated receptor 6 [Source:HGNC Symbol;Acc:20978]
trace amine associated receptor 8 [Source:HGNC Symbol;Acc:14964]
Mouse Orthologues:
Taar5, Taar6, Taar7a, Taar7b, Taar7d, Taar7e, Taar7f, Taar8a, Taar8b, Taar8c, Taar9
Mouse Descriptions:
trace amine-associated receptor 5 Gene [Source:MGI Symbol;Acc:MGI:2685073]
trace amine-associated receptor 6 Gene [Source:MGI Symbol;Acc:MGI:2685074]
trace amine-associated receptor 7A Gene [Source:MGI Symbol;Acc:MGI:2685075]
trace amine-associated receptor 7B Gene [Source:MGI Symbol;Acc:MGI:3527438]
trace amine-associated receptor 7D Gene [Source:MGI Symbol;Acc:MGI:3527443]
trace amine-associated receptor 7E Gene [Source:MGI Symbol;Acc:MGI:3527445]
trace amine-associated receptor 7F Gene [Source:MGI Symbol;Acc:MGI:3527447]
trace amine-associated receptor 8A Gene [Source:MGI Symbol;Acc:MGI:2685076]
trace amine-associated receptor 8B Gene [Source:MGI Symbol;Acc:MGI:2685995]
trace amine-associated receptor 8C Gene [Source:MGI Symbol;Acc:MGI:3527452]
trace amine-associated receptor 9 Gene [Source:MGI Symbol;Acc:MGI:3527454]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24884 Splice Site, Nonsense Mutation detected in F1 DNA During 2014
sa21801 Nonsense Mutation detected in F1 DNA During 2014
sa7340 Missense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24884
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142464 Nonsense 50 340 1 1
ENSDART00000144014 Splice Site None 295 None 2
Genomic Location:
Chromosome 10 (position 41850488)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAAGCGCAAGTCATGGATATATCATCATCTATGTGTTTGTGTCATTGT[T/A]GTCAGCATGGACTGTGTTTCTGAACCTGCTGGTGATCATCTCCATCTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21801
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142464 Nonsense 194 340 1 1
ENSDART00000144014 Nonsense 166 295 2 2
Genomic Location:
Chromosome 10 (position 41850055)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGGATATTTTGACACTTTATACAAAACAGATGTGTGTTATGGACAGTG[T/A]TCATTCATTATGAGCTTTCATTGGATAGTCACTGATCTGTTCATGTCTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7340
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142464 Missense 303 340 1 1
ENSDART00000144014 Missense 275 295 2 2
Genomic Location:
Chromosome 10 (position 41849729)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCCACAATTMTAAATGTTTTGACWTGGGTTGTCTATGCTAACTCAGGTC[T/A]GAATCCTCTGGTTTATGCTTTATTTTACCCCTCGTTTAAGAAGACATTTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/uduu463y