taok3

Ensembl ID:
ENSDARG00000094052
ZFIN ID:
ZDB-GENE-060526-59
Description:
Novel protein similar to vertebrate TAO kinase 3 (TAOK3) [Source:UniProtKB/TrEMBL;Acc:B0S514]
Human Orthologue:
TAOK3
Human Description:
TAO kinase 3 [Source:HGNC Symbol;Acc:18133]
Mouse Orthologue:
Taok3
Mouse Description:
TAO kinase 3 Gene [Source:MGI Symbol;Acc:MGI:3041177]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1339 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1339
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134472 Nonsense 296 505 5 8

The following transcripts of ENSDARG00000094052 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 33808632)
KASP Assay ID:
554-1253.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGCTGATGCGGCACCAGCATCAAACTGAGCTGGAGAACCAGGAGGAGTA[C/A]AACAGTCGACGGCAGAGGGAGCTACACAGGAAGCATGCACTGGAACGCCG
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ie2otpvt