si:ch211-120k19.3

Ensembl ID:
ENSDARG00000094040
ZFIN ID:
ZDB-GENE-100922-99
Human Orthologue:
CGN
Human Description:
cingulin [Source:HGNC Symbol;Acc:17429]
Mouse Orthologue:
Cgn
Mouse Description:
cingulin Gene [Source:MGI Symbol;Acc:MGI:1927237]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22798 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22798
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138267 Essential Splice Site 67 76 2 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 18996330)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17026653
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCATGCAGAGCATGAACCGCGAGCTCAACACTCTCCGCTCCCAACTCAG[G/A]TAAGGACAATGACAGTTATGACTGTGTGTTCGCCGTTTTGTGTATGGAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link