si:ch211-227e10.2

Ensembl ID:
ENSDARG00000093984
ZFIN ID:
ZDB-GENE-050419-8
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A3KQD5]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40326 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40326
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143275 Nonsense 21 112 1 4

The following transcripts of ENSDARG00000093984 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 45126622)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 52688189
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACCGCATCTTTAGGACCGTCACCTGTCGGATTGGATCATGGATGCGCT[A/T]AAAAGATGGACGACGCGGATGACAAGGAAAGTGTGAGTACCGATTTTCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link