si:ch211-250k18.6

Ensembl ID:
ENSDARG00000093964
ZFIN ID:
ZDB-GENE-070912-245
Description:
Novel NACHT domain containing protein [Source:UniProtKB/TrEMBL;Acc:B0S8F7]
Human Orthologue:
NLRP6
Human Description:
NLR family, pyrin domain containing 6 [Source:HGNC Symbol;Acc:22944]
Mouse Orthologue:
Nlrp6
Mouse Description:
NLR family, pyrin domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:2141990]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37425 Nonsense Mutation detected in F1 DNA During 2017
sa29720 Nonsense Mutation detected in F1 DNA During 2017
sa39357 Splice Site, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37425
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000139587 Nonsense 95 714 2 6
ENSDART00000143041 Nonsense 174 519 3 3
Genomic Location (Zv9):
Chromosome 22 (position 9204266)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9235342
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGCTCAAGAGATACAGGTTGAATGCAGACATTTGTTTAAAGCGTCTGAA[C/T]AAGACAAGCAGATCAGAACTGTCCTGACAAAAGGAGTCGCTGGCATCGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29720
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000139587 Nonsense 335 714 4 6
ENSDART00000143041 Nonsense 433 519 3 3
Genomic Location (Zv9):
Chromosome 22 (position 9205043)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9236119
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGACACAGCTGTACACACACTTTCTGCGCTTTCAGATCCAGCAGAGCAGA[C/T]GAAAGTATGATGGAGAATACACACCAGATGTGTCCTGGGATAAAGACGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39357
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000139587 Splice Site, Nonsense 601 714 5 6
ENSDART00000143041   None 519 None 3
Genomic Location (Zv9):
Chromosome 22 (position 9205917)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9236993
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTGTATTTGTGCCACCTAATTCTGTGGTTGTTTTATTTCTCTTGTAGGT[T/A]AAATGATTGTAAGTTAACAGACAGAAGCTGTTCAACTCTGGCTGCAGGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link