si:dkey-112g5.12

Ensembl ID:
ENSDARG00000093963
ZFIN ID:
ZDB-GENE-081028-32
Description:
similar to serine protease (LOC799537), mRNA [Source:RefSeq DNA;Acc:NM_001110170]
Human Orthologue:
HTRA2
Human Description:
HtrA serine peptidase 2 [Source:HGNC Symbol;Acc:14348]
Mouse Orthologue:
Htra2
Mouse Description:
HtrA serine peptidase 2 Gene [Source:MGI Symbol;Acc:MGI:1928676]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22228 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22228
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102121   None 195 None 9
ENSDART00000140820 Essential Splice Site None 191 None 6
ENSDART00000143783 Essential Splice Site None 202 None 7
Genomic Location (Zv9):
Chromosome 13 (position 8436078)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 8738598
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACCCACTCTAGCCTAAATAAGGACTGAACCTAAGTGAACGCTAACAGG[T/C]AGGAATAATGATCAAATTCTTGTGGATTAAACATCTTTATTGACATCAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link