si:ch73-26o5.1

Ensembl ID:
ENSDARG00000093945
ZFIN ID:
ZDB-GENE-081104-272
Description:
Vacuolar ATPase assembly integral membrane protein VMA21 [Source:UniProtKB/Swiss-Prot;Acc:B8JLV7]
Human Orthologue:
VMA21
Human Description:
VMA21 vacuolar H+-ATPase homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:22082]
Mouse Orthologues:
2610030H06Rik, Vma21-ps
Mouse Descriptions:
RIKEN cDNA 2610030H06 gene Gene [Source:MGI Symbol;Acc:MGI:1914298]
VMA21 vacuolar H+-ATPase homolog (S. cerevisiae), pseudogene Pseudogene [Source:MGI Symbol;Acc:MGI:3

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6971 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6971
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142112 Nonsense 4 104 1 3
Genomic Location (Zv9):
Chromosome 5 (position 24461234)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 22174106
KASP Assay ID:
554-5463.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACGGTTTTCTTATTTTGGTCGATGAAAAAAAACACAAAATGCAAAATTA[C/A]GACAAGAAAGAGGTGGGCTCAGTGCCCGGAGCCATGCCTRATTTCAGAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link