cnn1b

Ensembl ID:
ENSDARG00000093937
ZFIN ID:
ZDB-GENE-091118-54
Human Orthologue:
CNN1
Human Description:
calponin 1, basic, smooth muscle [Source:HGNC Symbol;Acc:2155]
Mouse Orthologue:
Cnn1
Mouse Description:
calponin 1 Gene [Source:MGI Symbol;Acc:MGI:104979]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1227 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1227
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000133772 Essential Splice Site 218 296 7 7
ENSDART00000141018 Essential Splice Site 199 277 6 6
Genomic Location:
Chromosome 3 (position 13617817)
KASP Assay ID:
554-1136.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGCTTTAAATGCCATGCATAAATTATTTCACTTCCTCTTCTTTCTATC[A/T]GGCTGGTATGACAGCTCCAGGCACCAAGCGGCAAATCTTCGAGAAGAAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/na1879e2