ftr04

Ensembl ID:
ENSDARG00000093932
ZFIN ID:
ZDB-GENE-070912-226
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0S722]
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39907 Nonsense Mutation detected in F1 DNA During 2016
sa18101 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39907
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134034 Nonsense 131 361 1 4
ENSDART00000140203 Nonsense 116 291 1 3
Genomic Location (Zv9):
Chromosome 2 (position 42361486)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42410950
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGAGTGTGATGTTTGTACTGGGAGAAAATATAAAGCTGTTAAATCTTG[T/A]CTGGTGTGTCTGGAATCTTACTGTCTGATTCACTTTGAACAACACGAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18101
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134034 Nonsense 319 361 3 4
ENSDART00000140203   None 291 None 3
Genomic Location (Zv9):
Chromosome 2 (position 42362454)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42411918
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGGAGAAACRCTGAGCTGSAGCAGCTTTCAGGCACAGACCATCACATCTA[T/G]TTYCTCCAGGTANNACAGATCTGACAAACAGCTCRCTGTGTTTAATAAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link