si:ch211-232d10.1

Ensembl ID:
ENSDARG00000093925
ZFIN ID:
ZDB-GENE-081103-11

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7275 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7275
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134613 Nonsense 796 974 6 7
ENSDART00000145567   None 736 None 6
Genomic Location (Zv9):
Chromosome 4 (position 61480170)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 74389161
KASP Assay ID:
554-4497.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTAYAGTCTGRATCATGGAGGAGAGACGAGGATTACAGCAGGACCACRC[A/T]AATGTAGGACTACACACACACACACACACAMTCACACACACACACACACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link