trhr2

Ensembl ID:
ENSDARG00000093901
ZFIN ID:
ZDB-GENE-050419-193
Description:
thyrotropin releasing hormone receptor 2 [Source:RefSeq peptide;Acc:NP_001037811]
Mouse Orthologue:
Trhr2
Mouse Description:
thyrotropin releasing hormone receptor 2 Gene [Source:MGI Symbol;Acc:MGI:2177284]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36617 Nonsense Mutation detected in F1 DNA During 2016
sa10321 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa36617
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000140654 Nonsense 453 497 3 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 16832951)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17184717
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGGACGTGGACATGAGCAAGATTAATGATAATGGGAAAATAATGGAG[G/T]AAAGCGGTAATAGTGCTCAGGATATTATCGCTGACATGAGCAACACACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10321
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000140654 Nonsense 473 497 3 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 16833011)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 17184777
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAGTGCTCAGGATATTATCGCTGACATGAGCAACACACAGCAGACACAA[C/T]GAGTGTCCGGTGAATTCACATCTWCTCTGGGRGWAGCAGAACAGAATGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link