LOC571201

Ensembl ID:
ENSDARG00000093893
Human Orthologue:
CCBL2
Human Description:
cysteine conjugate-beta lyase 2 [Source:HGNC Symbol;Acc:33238]
Mouse Orthologue:
Ccbl2
Mouse Description:
cysteine conjugate-beta lyase 2 Gene [Source:MGI Symbol;Acc:MGI:2677849]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1832 Essential Splice Site Available for shipment Available now
sa38549 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa1832
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000139731 Essential Splice Site 218 448 6 13
Genomic Location (Zv9):
Chromosome 6 (position 21433813)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 25121544
KASP Assay ID:
554-1823.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAAAACCAAGGCTATCATCATCAACACTCCTAATAAYCCTATTGGAAAA[G/A]TAAGGTCACATACAGTTAAAGTCAGAATTRWTAGCCCCCCTTTGATTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38549
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000139731 Essential Splice Site 314 448 9 13
Genomic Location (Zv9):
Chromosome 6 (position 21439971)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 25127702
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGACTGTCATGCAGAACAGTCTGTATACATGTCCAACACCATTACAGG[C/T]AAGTTCTGGATGTGGTATTTTATGGTTCTGGTTGTATACAATCCACTTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link