Q5SPS0_DANRE

Ensembl ID:
ENSDARG00000093883
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:Q5SPS0]
Human Orthologue:
C6orf204
Human Description:
chromosome 6 open reading frame 204 [Source:HGNC Symbol;Acc:21638]
Mouse Orthologue:
Gm9766
Mouse Description:
predicted gene 9766 Gene [Source:MGI Symbol;Acc:MGI:3642684]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23786 Nonsense Available for shipment Available now
sa23787 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23786
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143169 Nonsense 121 286 2 2

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 41938891)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 42010050
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCACCTCTCGACATCCCCCTGGACATGAAGGATCCCCGTCCCGTGCGT[C/T]GATGGTCCTCCCTCACCCGCCTCACCGCCCAAGAAAAGCCCTCTCCAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23787
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000143169 Nonsense 196 286 2 2

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 20 (position 41939118)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 42010277
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTATGACCTGGGTAGCAGCAACACTTTAGGTAAATCGGACTCATGTTG[T/A]TCATCTCCCCTGAAGCCGAGTACACTAGACCTCAGTTTTAGTGCCTTACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link