ENSDARG00000093869

Ensembl ID:
ENSDARG00000093869
Mouse Orthologue:
Cacna1b
Mouse Description:
calcium channel, voltage-dependent, N type, alpha 1B subunit Gene [Source:MGI Symbol;Acc:MGI:88296]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44962 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44962
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000140082 Nonsense 118 244 4 9

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 12694344)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 14395518
GRCz11 21 14492247
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTAATCCTAATTCTCTCTCTCTCTCTTCGTGTAGATACTGGAACTCTT[T/A]GCGGAATCTCGTGGTTTCTCTGTTAAACTCCATGAAGTCCATCATCAGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link