CD22 (32 of 32)

Ensembl ID:
ENSDARG00000093845
Description:
CD22 molecule [Source:HGNC Symbol;Acc:1643]
Human Orthologue:
CD22
Human Description:
CD22 molecule [Source:HGNC Symbol;Acc:1643]
Mouse Orthologue:
Cd22
Mouse Description:
CD22 antigen Gene [Source:MGI Symbol;Acc:MGI:88322]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31245 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa31245
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000134129 Essential Splice Site 17 416 2 9
Genomic Location (Zv9):
Chromosome 1 (position 57542977)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 56278081
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGTGTAACTGATAAACTATATTTTAGTCATGGCTATCTCTGTGTTTC[A/T]GGGGTTTCTGCTGCTGATTGGGGTGTGAATTACAGTCCTTTACAAATCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link