LOC100150315

Ensembl ID:
ENSDARG00000093826

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21723 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21723
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000136123 Essential Splice Site 246 515 7 9

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 22946275)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 22776613
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATGTCCTGGAGCCTGTCTGAGAAGAGGTCCTCCCCCTCCCGCTTTCAG[G/A]TTGGCCAGGGCTTTCAGTTGTGTTTTTAGTACAGTCGATTTTCTCTATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link