LOC100150315

Ensembl ID:
ENSDARG00000093826

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7646 Essential Splice Site Mutation detected in F1 DNA During 2014
sa21723 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7646
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000136123 Essential Splice Site None 515 2 9
Genomic Location:
Chromosome 10 (position 22943627)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATCTCTGTTGAGATCTGCAGTGGAGGGTTTCTCAGACTCATCAGCGTGG[T/A]GAGTTTTCAMGGGATGCTTTTTTCTTTCCAGAATATGGTGCAGCAMGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21723
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000136123 Essential Splice Site 246 515 7 9

The following genes are also affected by this mutation:

Genomic Location:
Chromosome 10 (position 22946275)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATGTCCTGGAGCCTGTCTGAGAAGAGGTCCTCCCCCTCCCGCTTTCAG[G/A]TTGGCCAGGGCTTTCAGTTGTGTTTTTAGTACAGTCGATTTTCTCTATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1v4hq92d