si:ch211-14a17.10

Ensembl ID:
ENSDARG00000093813
ZFIN ID:
ZDB-GENE-030616-581
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0R0G7]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38346 Nonsense Mutation detected in F1 DNA During 2017
sa39894 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38346
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131722 Nonsense 32 162 4 9
Genomic Location (Zv9):
Chromosome 2 (position 37956629)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38271543
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATGCAGTAGATCATTTGTTCTTCTTTAGGCCTACAGAAAGATCTTGAT[G/T]AGATGAAGGATAAATGTATGGAGTTTTACAAAGAAGCAAAAGATAATATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39894
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131722 Nonsense 75 162 6 9

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 37953475)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 38268389
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCACCTCTGTTTCACCACTTTCACCTCTGTGTTCCACCTATTCAGTCT[T/A]AAAGATTCTCCAGAAATTCGTCGAACTGCAGGAGATTGAAACGATAATGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link