ENSDARG00000093812

Ensembl ID:
ENSDARG00000093812

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6340 Nonsense Mutation detected in F1 DNA During 2016
sa35652 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6340
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000136809 Nonsense 11 160 1 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 13095178)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 12530951
KASP Assay ID:
554-4458.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGAGAGAAGCTGAAAAAAANTGACTCAAAGCGCGTTGATTTTTTTATTAT[G/A]GCTTTTCGGCACGTCTCTCGCTGGCTTCCCCAATCAGATAAATATCGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35652
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000136809 Nonsense 126 160 3 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 13035948)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 12471721
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTCCACACCTCCTTTGTCACACCCAGTTACCCCATCGACTCAGATGTG[C/T]AGTTTGTCATCCAGATGCGCCCTCCATTGAAGGGTGCTGTCTTAAGTCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link