si:dkey-21k24.6

Ensembl ID:
ENSDARG00000093805
ZFIN IDs:
ZDB-GENE-061207-56, ZDB-GENE-080812-3
Description:
Putative novel protein [Source:UniProtKB/TrEMBL;Acc:A2BG01]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa851 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa851
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142943 Nonsense 165 212 3 3
Genomic Location (Zv9):
Chromosome 25 (position 15599721)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 15146265
KASP Assay ID:
554-0754.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTGCGACAAGACTGCACTCCTACTGTCCCTCCTCCCAAACTCCAGAGCT[T/A]GGAGAAACAGGACTGGCCTATGACATCCAGCTCTGAAGGAAAAGAYGAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link