itln2

Ensembl ID:
ENSDARG00000093796
ZFIN ID:
ZDB-GENE-050411-58
Human Orthologues:
ITLN1, ITLN2
Human Descriptions:
intelectin 1 (galactofuranose binding) [Source:HGNC Symbol;Acc:18259]
intelectin 2 [Source:HGNC Symbol;Acc:20599]
Mouse Orthologues:
Gm9765, Itln1
Mouse Descriptions:
intelectin 1 (galactofuranose binding) Gene [Source:MGI Symbol;Acc:MGI:1333831]
predicted gene 9765 Gene [Source:MGI Symbol;Acc:MGI:3642721]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38623 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38623
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000073554 Essential Splice Site 44 305 1 6
Genomic Location (Zv9):
Chromosome 7 (position 34472501)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 32866841
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGCTCGAAGCTGCAAAGAAATCCGTGACAAGTACTATGTTTATGAGG[G/A]TATGATCTCATTCTATATCTTTTATTTGTAATGTTAGACAGCATCTGCAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link