
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-202a12.9
- Ensembl ID:
- ENSDARG00000093779
- ZFIN ID:
- ZDB-GENE-060526-79
- Description:
- Novel protein containing a small cytokines (Intecrine/chemokine), interleukin-8 like domain [Source:
- Human Orthologue:
- CXCL11
- Human Description:
- chemokine (C-X-C motif) ligand 11 [Source:HGNC Symbol;Acc:10638]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa31469 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa31469
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000137224 | Essential Splice Site | 92 | 121 | 3 | 4 |
- Genomic Location (Zv9):
- Chromosome 5 (position 43689607)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 5 41470872 GRCz11 5 42071025 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCAGACTCAAAATTCACCAAAAATGTCGTCTTAAAGGCTATTGGGAAAAG[G/T]TGAGAATTTCTGCTTAAGTATATTTATGTCTGCTTCACAGATATATTCAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: