htr1aa

Ensembl ID:
ENSDARG00000093745
ZFIN ID:
ZDB-GENE-071203-1
Description:
5-hydroxytryptamine receptor 1A [Source:RefSeq peptide;Acc:NP_001116793]
Human Orthologue:
HTR1A
Human Description:
5-hydroxytryptamine (serotonin) receptor 1A [Source:HGNC Symbol;Acc:5286]
Mouse Orthologue:
Htr1a
Mouse Description:
5-hydroxytryptamine (serotonin) receptor 1A Gene [Source:MGI Symbol;Acc:MGI:96273]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31665 Nonsense Available for shipment Available now
sa41249 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31665
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138217 Nonsense 96 398 1 1
Genomic Location (Zv9):
Chromosome 8 (position 32790080)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31932806
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGGTGCTCCCCATGGCAGCCCTGTATCAGGTTTTGAATAAATGGACTT[T/A]GGGACAGGAGATGTGCGATATTTTCATCTCTCTAGACGTGCTGTGCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41249
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138217 Nonsense 267 398 1 1
Genomic Location (Zv9):
Chromosome 8 (position 32790592)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31933318
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGTAAAACTTGGAGGCGAAGCGTGGAGCCGTGCGCAAACGGCGCGCTG[A/T]AAAACTCGGACGACGGAGAGTCGTTCGAGATTACAGAAGTTCAAAGCATC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link