LOC100001366

Ensembl ID:
ENSDARG00000093715
Human Orthologues:
MYH6, MYH7
Human Descriptions:
myosin, heavy chain 6, cardiac muscle, alpha [Source:HGNC Symbol;Acc:7576]
myosin, heavy chain 7, cardiac muscle, beta [Source:HGNC Symbol;Acc:7577]
Mouse Orthologues:
Myh6, Myh7
Mouse Descriptions:
myosin, heavy polypeptide 6, cardiac muscle, alpha Gene [Source:MGI Symbol;Acc:MGI:97255]
myosin, heavy polypeptide 7, cardiac muscle, beta Gene [Source:MGI Symbol;Acc:MGI:2155600]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8514 Essential Splice Site Mutation detected in F1 DNA During 2016
sa37967 Nonsense Mutation detected in F1 DNA During 2016
sa24571 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa8514
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135233 Essential Splice Site 1330 1942 26 37
Genomic Location:
Chromosome 24 (position 42317586)
KASP Assay ID:
2261-9146.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACACCCAGCAGATTGAGGACCTCAGGAGACAACTTGAGGAAGAAGTCAAG[G/A]TATATTTGATTTTTTTTTCTATTGTTCTGTTAGTATAACTTTTGTCAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37967
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135233 Nonsense 1440 1942 28 37
Genomic Location:
Chromosome 24 (position 42316910)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAAGCACAGGCTCCAGAATGAGATTGAAGATCTTATGGTGGACGTGGAG[A/T]GATCCAATGCTGCTGCTGCTGCTCTGGACAAGAAGCAAAGAAACTTTGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24571
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000135233 Nonsense 1541 1942 30 37
Genomic Location:
Chromosome 24 (position 42316060)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCTGGAAAGAACATACATGAACTGGAGAAAATCCGTAAGCAGTTGGAG[C/T]AGGAAAAGGCTGAAATTCAAACTGCTCTGGAGGAAGCTGAGGTGTGTATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link