si:ch73-138n13.2

Ensembl ID:
ENSDARG00000093693
ZFIN ID:
ZDB-GENE-091204-442
Human Orthologue:
KIAA1671
Human Description:
KIAA1671 [Source:HGNC Symbol;Acc:29345]
Mouse Orthologue:
2900026A02Rik
Mouse Description:
RIKEN cDNA 2900026A02 gene Gene [Source:MGI Symbol;Acc:MGI:1920194]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41276 Nonsense Mutation detected in F1 DNA During 2017
sa13366 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41276
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142238 Nonsense 85 194 1 2

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 44729165)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 42681947
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTGCAGCACCTATACTGGCTCCAGAGAGATGCTGGACCTCAGTACCTT[T/G]AAATGTAGGGTCAATTGGAGATTCAGTTTCTTCTCCCCCAACACCATTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13366
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000142238 Nonsense 101 194 1 2

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 44729117)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 42681899
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTRAATGTAGGGTCAATTGGAGATTCAGTTTCTTCTCCCCCAACACCAT[T/A]ATCTAGAAAAGAAACTTCAAGACCCAGAAGTCAAGCCTCAGCCCTGTCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link