si:dkey-193c22.1

Ensembl ID:
ENSDARG00000093687
ZFIN ID:
ZDB-GENE-030131-7957
Description:
hypothetical protein LOC567837 [Source:RefSeq peptide;Acc:NP_001093504]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9963 Nonsense Available for shipment Available now
sa18814 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9963
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131323 Nonsense 249 370 8 9
ENSDART00000131323 Nonsense 249 370 8 9
Genomic Location (Zv9):
Chromosome 5 (position 41828390)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39603107
KASP Assay ID:
2259-6295.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGYTTTTGTAATAGGTCTGAGTGGAGTTTACAGCATAATGGATCATTA[T/G]AACCATGAGAAAGTGCGGGCTGTTGAATACGTGTCAACTATGCATAAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18814
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131323 Nonsense 249 370 8 9
ENSDART00000131323 Nonsense 249 370 8 9
Genomic Location (Zv9):
Chromosome 5 (position 41828390)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 39603107
KASP Assay ID:
2259-6295.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGCTTTTGTAATAGGTCTGAGTGGAGTTTACAGCATAATGGATCATTA[T/G]AACCATGAGAAAGTGCGGGCTGTTGAATACGTGTCAACTATGCATAAAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link