ftr25

Ensembl ID:
ENSDARG00000093651
ZFIN ID:
ZDB-GENE-070912-323
Description:
Novel protein with Zinc finger, C3HC4 type (RING finger) and B-box zinc finger domains [Source:UniPr
Human Orthologue:
TRIM65
Human Description:
tripartite motif-containing 65 [Source:HGNC Symbol;Acc:27316]
Mouse Orthologue:
Trim65
Mouse Description:
tripartite motif-containing 65 Gene [Source:MGI Symbol;Acc:MGI:2442815]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa33022 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa33022
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000098047 Nonsense 546 553 8 8
ENSDART00000143023   None 360 None 4

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 48047557)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 48079221
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAACATTCACTCAACCGCTCTACCCTGGGTTTGGGATTAATTTTGGAT[C/A]AACAATAAAACTTCTATTGTTGAAGTCCTTATGAACTATAAGATAATTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link