si:ch211-249h16.8

Ensembl ID:
ENSDARG00000093630
ZFIN ID:
ZDB-GENE-090311-36

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38774 Nonsense Mutation detected in F1 DNA During 2017
sa27547 Nonsense Mutation detected in F1 DNA During 2017
sa41583 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa38774
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000141692 Nonsense 337 597 5 10

The following transcripts of ENSDARG00000093630 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 5156276)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5152570
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTTCAGGATCTGTGGTGTCTCATTTTAAAGTCAGAAACATGATTGGA[C/T]AAGGAGCTTTTGGCCAGGTGTATTTGGCGTCTGACGTATCAAGTGAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27547
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000141692 Nonsense 344 597 5 10

The following transcripts of ENSDARG00000093630 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 5156299)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5152593
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTTTAAAGTCAGAAACATGATTGGACAAGGAGCTTTTGGCCAGGTGTA[T/A]TTGGCGTCTGACGTATCAAGTGAAAAAGAAAAGGTAGAGAAGTATTTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41583
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000141692 Nonsense 445 597 7 10

The following transcripts of ENSDARG00000093630 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 5158764)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 5155058
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAAAAAGACATCGGACATGGATGAAAACAAAGCACGCCGGTTAATGCGT[C/T]AGTTGGTCCAAGCTGTCAAGTTCTGCGTTGAACGTGGAGTTTTCCATGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link