si:ch211-250k18.3

Ensembl ID:
ENSDARG00000093613
ZFIN ID:
ZDB-GENE-060503-695
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A3KQR2]
Human Orthologues:
NLRP12, RNH1
Human Descriptions:
NLR family, pyrin domain containing 12 [Source:HGNC Symbol;Acc:22938]
ribonuclease/angiogenin inhibitor 1 [Source:HGNC Symbol;Acc:10074]
Mouse Orthologue:
Rnh1
Mouse Description:
ribonuclease/angiogenin inhibitor 1 Gene [Source:MGI Symbol;Acc:MGI:1195456]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32375 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32375
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000147335 Essential Splice Site 117 174 2 4
Genomic Location (Zv9):
Chromosome 22 (position 9252353)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 9283429
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCTTATGTGATGTACTGAAGGATTCACACTGTAAACTGGAGACACTGAG[G/A]TGAGAAACTTTCACAAAATTAAACAATTTAAATCAAAACACTTCATATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link